WWW.ДЕНЬСИЛЫ.РФ

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Медицина

 

Pages:   || 2 | 3 | 4 |

Структура гена новой металлопротеиназы bacillus intermedius и регуляция его экспрессии

-- [ Страница 1 ] --

ФГАОУВПО «Казанский (Приволжский) федеральный университет»

На правах рукописи

САБИРОВА АЛЬБИНА РУШАНОВНА

СТРУКТУРА ГЕНА НОВОЙ МЕТАЛЛОПРОТЕИНАЗЫ

BACILLUS INTERMEDIUS И РЕГУЛЯЦИЯ ЕГО ЭКСПРЕССИИ

03.02.03 – микробиология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Казань – 2011

Работа выполнена в лаборатории биосинтеза и биоинженерии ферментов кафедры микробиологии биолого-почвенного факультета ФГАОУВПО «Казанский (Приволжский) федеральный университет».

Научный руководитель: Доктор биологических наук, профессор

Шарипова Маргарита Рашидовна

Официальные оппоненты: Доктор биологических наук

Коксин Владимир Петрович

Кандидат биологических наук

Давыдова Марина Николаевна

Ведущая организация: Казанский научно-исследовательский институт

эпидемиологии и микробиологии

Защита диссертации состоится «24» февраля 2011 г. в 13-00 часов на заседании диссертационного совета Д.212.081.08 при ФГАОУВПО «Казанский (Приволжский) федеральный университет» по адресу: 420008, г. Казань, ул. Кремлевская, 18, главное здание, ауд. 211.

Факс 8(843)238-71-21, 233-78-40. E-mail: albina-12@mail.ru

С диссертацией можно ознакомиться в научной библиотеке им. Н.И. Лобачевского Казанского федерального университета

Автореферат разослан «_____» января 2011 г.

Ученый секретарь З. И. Абрамова

диссертационного совета,

доктор биологических наук

Актуальность. Протеолитические белки вовлечены во все основные физиологические процессы, включая регуляторный протеолиз, и являются стратегическими ферментами клеток микроорганизмов. По результатам секвенирования геном Bacillus subtilis содержит 62 гена протеолитических белков, среди которых 34 гена кодируют цитоплазматические протеиназы, 13 - мембраносвязанные протеазы, 6 - протеазы, локализованные в клеточной стенке и 9 генов кодируют секретируемые протеазы [Rey et al., 2004]. Многие из белков, соответствующих этим генам, пока не выделены, их физиологические функции не установлены. В международных базах данных содержится обширная информация о фрагментах последовательностей геномных ДНК различных видов бацилл, в том числе B.subtilis, B.cereus, B.licheniformis и других, что позволяет проводить геноинформационный анализ по идентификации генов и сравнению фрагментов геномов. Особый научно-практический интерес представляют ранее не идентифицированные белки протеолитического спектра, что обусловлено необходимостью расширения общих представлений об эволюционном развитии этой группы гидролаз, и выявления новых, практически значимых, ферментов с полезными свойствами.

Бациллы в ходе эволюции выработали сложную и разветвленную регуляторную систему, в основе которой лежит механизм сигнальной трансдукции, а именно, сеть двухкомпонентных систем регуляции экспрессии генов [Aguilar et al, 2001]. Выяснение регуляторных сетей, управляющих экспрессией поздних генов, к которым относятся гены протеолитических белков, открывает новые перспективы в микробной биотехнологии. Молекулярные механизмы, контролирующие интегрированный ответ микробной клетки на изменения среды, в настоящее время изучены недостаточно. Вклад разных систем регуляции в клеточный ответ можно оценить с помощью мутантных штаммов с дефектными регуляторными белками. Способы регуляции экспрессии поздних генов отражены в структуре промоторов, анализ которых позволяет определить потенциальные механизмы активации транскрипции.

Целью работы явился поиск, изоляция и характеристика гена новой металлоэндопептидазы (mprBi) из фрагмента хромосомной ДНК B.intermedius и изучение его экспрессии.

Основные задачи исследования:

1. Установить последовательность нуклеотидов 6 кб фрагмента хромосомной ДНК B.intermedius, провести поиск, идентификацию и характеристику открытых рамок считывания генов, включая гены протеолитических белков.

2. Клонировать ген внеклеточной металлопротеиназы B.intermedius и провести анализ его структурной организации.

3. Изучить экспрессию гена mprBi в штамме, мутантном по регуляторным белкам DegS-DegU системы сигнальной трансдукции, контролирующей синтез ферментов деградации.

4. Исследовать влияние фактора транскрипции TnrA, одного из регуляторов азотного обмена у бацилл, на экспрессию гена металлопротеиназы B.intermedius.

5. Изучить экспрессию гена mprBi в штаммах бацилл, дефектных по Spo-белкам, участвующих в споруляции у бацилл.

Научная новизна. Основной научный приоритет работы заключается в идентификации у бацилл нового гена секретируемой металлоэндопептидазы – первого бактериального гомолога эукариотических адамализинов. Установлена последовательность нуклеотидов 6 кб фрагмента хромосомной ДНК B.intermedius, в которой выявлены шесть открытых рамок считывания (AN EU678894). Впервые у микроорганизмов изолирован ген mprBi, кодирующий внеклеточную металлопротеиназу B.intermedius семейства М12 адамализинов/репролизинов клана метцинкинов. Получены приоритетные данные о зависимости экспрессии гена адамализиноподобной металлопротеиназы от DegS-DegU регуляторной системы, контролирующей синтез ферментов биодеградации, TnrA фактора транскрипции, участвующего в азотном обмене, механизма катаболитной репрессии, а также об отсутствии корреляции экспрессии гена mprBi с процессом спорообразования.



Практическая значимость результатов. Секвенированный фрагмент хромосомной ДНК, содержащий ген металлопротеиназы B.intermedius, занесен в базу данных Международного ГенБанка (AN EU678894) и может быть использован для сравнительного анализа генов и геномов. Результаты секвенирования полного гена mprBi позволили оценить последовательность продукта трансляции, включая сигнальный пептид и пропептидную область белка, а также провести его корректную классификацию. Получен вектор экспрессии pSA1, несущий 1,2 кб вставку с геном mprBi для выделения соответствующего белка и изучения его свойств. Данные о структуре промотора и контроле экспрессии гена mprBi могут быть использованы при конструировании систем экспрессии на основе модификации промотора для практического применения.

Связь работы с научными программами. Работа выполнялась в соответствии с планом НИР Казанского федерального университета (№ гос. регистрации 01:02.00 104982 «Биосинтез, биогенез, классификация, физиологические функции новых микробных ферментов и возможные области их практического применения»). Исследования выполнены при поддержке грантов РФФИ №05-04-48182 и №09-04-99044, Федеральной целевой программы «Научные и научно-педагогические кадры инновационной России» 2009-2013 гг: ГК № П344, ГК № П406, ГК № П323, грантом Академии наук Республики Татарстан №14-24/2010 (Г).

Положения, выносимые на защиту:

  1. Изолированный и охарактеризованный ген B.intermedius кодирует новую металлоэндопептидазу бацилл, которая относится к семейству адамализинов/репролизинов клана метцинкинов и является первым прокариотическим гомологом эукариотических адамализинов.
  2. Экспрессия гена mprBi контролируется системой DegS-DegU, которая отвечает за синтез ферментов деградации, фактором транскрипции TnrA, регулирующим азотный обмен при дефиците этого источника питания, и не зависит от Spo-регуляторных белков, участвующих в контроле споруляции.

Апробация работы. Основные положения диссертации были представлены на международной научной конференции «Ферменты микроорганизмов: структура, функции, применение» (Казань, 2005 г.), Международных конференциях для студентов, аспирантов и молодых ученых «Ломоносов» (Москва, 2007, 2008 гг.), Международном симпозиуме «Химия протеолитических ферментов» (Москва, 2007 г.), Международной научной студенческой конференции «Студент и научно-технический прогресс» (Новосибирск, 2008 г.), Российском симпозиуме «Белки и пептиды» (Казань, 2009 г.), Российской школе молодых ученых «Актуальные проблемы современной биохимии и молекулярной биологии» (Казань, 2010 г.), Всероссийской молодежной научной конференции «Современные биологические аспекты в фундаментальных исследованиях молодых ученых» (Томск, 2010 г.) и Итоговых научных конференциях студентов КФУ (Казань, 2005, 2007 гг.), Итоговых научных конференциях сотрудников КФУ (Казань, 2008, 2009, 2010 гг.).

Публикации. По теме диссертации опубликовано 20 научных работ, из них 6 статей в центральных отечественных и зарубежных рецензируемых журналах.

Структура и объем диссертации: Диссертация состоит из введения, обзора литературы, описания материалов и методов исследований, раздела экспериментальных исследований, обсуждения результатов, выводов и списка литературы. Работа изложена на 150 страницах машинописного текста, включает 7 таблиц, 38 рисунков. Библиография содержит 208 наименований, в т.ч. 202 - зарубежных авторов.

Благодарности. Автор выражает глубокую признательность своему научному руководителю профессору М. Р. Шариповой за постановку проблемы, внимательное отношение к работе и плодотворное обсуждение полученных результатов; к.б.н., с.н.с. Н. П. Балабан и к.б.н., доц. А. М. Мардановой за постоянное внимание, помощь в работе и консультации. Отдельная благодарность выражается профессору С. В. Кострову (ИМГ РАН, Москва), к.б.н., в.н.с. И. В. Демидюку (ИМГ РАН, Москва), профессору Е. Феррари (Международная инкорпорация Генкор, США), профессору Д. Зайглеру (Bacillus Stock Center, Университет Охайо, США), профессору Е. Сахилду (Университет Копенгагена, Дания), профессору Й.Штульке (университет Геттингена, Германия), профессору Я. Маартену Ван Дижлу (университет Гронингена, Голландия) за предоставление для работы лабораторных штаммов и плазмид. Автор искренне благодарен заведующей кафедрой микробиологии КФУ профессору О. Н. Ильинской и сотрудникам кафедры за всестороннюю помощь и доброжелательную рабочую атмосферу.

МАТЕРИАЛЫ И МЕТОДЫ

Штаммы бактерий, векторы, плазмиды и среды культивирования. Объектом исследования являлся рекомбинантный эритромициноустойчивый штамм Bacillus subtilis. Он получен путем трансформации плазмиды pSA1 в протеазо-дефицитный штамм B.subtilis BG 2036, из хромосомы которого делетированы гены внеклеточных протеиназ (штамм предоставлен проф. Eugenio Ferrarri, Genencor Int. Inc., USA). Мультикопийная плазмида pSA1 сконструирована на основе вектора экспрессии pCB22 [Sorokin et al., 1990] и несет полный ген металлопротеиназы B.intermedius (mprBi) под собственным промотором. Ген субклонирован после секвенирования 6 кб фрагмента геномной ДНК B.intermedius с плазмиды рСМ4 (плазмида pCM4 предоставлена проф. С. В. Костровым, ИМГ РАН, г. Москва). Штаммы B.subtilis 8G5 degSdegU (like 8G5; degS, degU; Kmr), с мутацией по генам degS и degU, B.subtilis 8G5 degU32(Hy) (like 8G5; degU32(Hy); Kmr) с мутацией по гену degU, ведущей к Hy-фенотипу и B.subtilis 8G5 (trpC2; tyr; his; nic; ura; rib; met; ade; sipP) с полноценными регуляторными белками предоставлены доктором Я. Маартен Ван Дижлом, университет Гронингена, Голландия. Штамм B.subtilis tnrA-LCC с мутацией по гену tnrA (EmR), предоставлен профессором Е. Сахилдом, Университет Копенгагена, Дания. Штаммы B.subtilis GP 254 (trpC2; amtB, Cmr), B.subtilis GP 253 (trpC2; glnK, Cmr) предоставлены проф. Й. Штульке, университет Геттингена, Германия. Штаммы, дефектные по spo-зависимым генам, и B.subtilis 168 (trpC2) предоставлены профессором Д. Зейглером из Bacillus Genetic Stock Center (BGSC), Университет Охайо, США.





Культивирование бактерий проводили на следующих средах: среда LB (%): триптон – 1,0; дрожжевой экстракт – 0,5; NaCl – 0,5; pH 8.5 [Sambrook et al., 1989]. Агаризованная среда LА включала дополнительно 2% агара. Среды для трансформации штаммов B.subtilis включали солевую основу cреды Спицайзена, среду Спицайзена I и среду Спицайзена II [Anagnostopolous, Spizizen, 1961]. Синтетическая минимальная среда SMM включала солевую основу, микроэлементы [Saxild et al., 1987]. Идентификационная агаризированная среда для отбора клонов, способных секретировать протеиназу, включала 30% обезжиренного молока и 2% агара. Среды стерилизовали при 1 атм. в течение 30 мин., рН доводили перед стерилизацией среды 40%-ным раствором NaOH до значения 8,5. Для изучения влияния углеродной катаболитной репрессии в среду SMM вносили 10 мМ глюкозы. Для изучения влияния азотной катаболитной репрессии в среду SMM вносили соли NaNO3 и NH4Cl в конечной концентрации 20 мМ.

При выращивании рекомбинантных штаммов в среду вносили антибиотики (конечная концентрация в среде): для штаммов B.subtilis с плазмидами pCB22, pCМ4, pSA1– эритромицин (20 мкг/мл); для штаммов B.subtilis, мутантных по белкам AmtB и ClnK - хлорамфеникол (20 мкг/мл); для штаммов B.subtilis, мутантных по белкам DegS и DegU, канамицин (20 мкг/мл).

Выделение плазмидной ДНК проводили с помощью набора реактивов GeneJET Plasmid Miniprep Kit (Fermentas). Электрофорез плазмидной ДНК проводили по методу, описанному ранее [Sambrook et al., 1989].

Рестрикционное картирование ДНК. Последовательность фрагмента геномной ДНК B.intermedius анализировали с помощью программы Vector NTI и определяли потенциальные сайты рестрикции. Амплификат 6 кб фрагмента ДНК B.intermedius обрабатывали рестриктазами в разных комбинациях: BglII, DraI, HindII, NdeI, PvuII, SacI, SalI, XbaI. Рестрикцию ДНК проводили набором рестриктаз фирмы “Сибэнзим” в течение 2 ч при 37° С в условиях, рекомендованных производителем.

Трансформацию клеток B. subtilis плазмидной ДНК проводили, как описано в работе [Anagnostopolous et al., 1961]. Трансформацию протопластов B.subtilis плазмидной ДНК проводили, как описано в работе [Chang et al., 1979].

Oпределение протеолитической активности металлопротеиназы проводили по расщеплению 1% азоказеина по методу, описанному ранее [Demidyuk et al., 2006]. Определение активности на синтетических хромогенных субстратах Z-Ala-Ala-Leu-pNA и Z-Glu-pNA проводили по методике, описанной в работе [Leshchinskaya et al., 1997]. Определение казеинолитической активности определяли по методу Каверзневой [Каверзнева, 1971]. За единицу активности принимали количество фермента, гидролизующего в условиях эксперимента 1 мкг субстрата за 1 мин. Продуктивность культуры определяли как отношение величины протеолитической активности к оптической плотности культуральной жидкости и выражали в усл. ед.

Исследование влияния ингибиторов на активность фермента. В реакционную смесь добавляли ингибитор в конечной концентрации 5 мМ и выдерживали пробу в присутствии реагента в течение 1 ч при комнатной температуре, после чего определяли остаточную активность по гидролизу азоказеина. Остаточную активность выражали в процентах. За 100% (контроль) принимали активность фермента в отсутствие ингибиторов в реакционной смеси. В работе использовали специфический ингибитор сериновых протеиназ PMSF, ингибиторы металлопротеиназ ЭДТА и 1,10-фенантролин, а также белковый ингибитор трипсина.

ДНК секвенирование. Фрагмент геномной ДНК B.intermedius размером в 5896 п.о. на плазмиде pCM4 амплифицировали с помощью синтетических олигонуклеотидов, комплиментарных фланкирующим областям плазмиды pCB22 (pCB rev – ATAGCTTTATAGAGTAGGTC, pCB dir – CCACTATCGACTACGCG). Условия проведения ПЦР реакции: 94° С 1 мин. - 1 цикл; 94° С 30 сек., 43° С 30 сек., 72° С 6 мин. – 30 циклов; 72° С 10 мин – 1 цикл. Результаты ПЦР реакции оценивали электрофоретически в 1% агарозном геле. В пробирки объемом 0,5 мл вносили стандартное количество праймера – 3,2 pmol. В зависимости от типа матрицы и ее размера концентрация праймеров (нг) варьировала: ПЦР-продукт: > 2000 п.о. – 20-50 нг; плазмида: 6000 – 10000 п.о. – 300-400 нг. Образцы упаривали в вакуумной центрифуге или в термостате при температуре 60-65° С, пробирки выдерживали при комнатной температуре 10-15 мин, чтобы избежать образования конденсата.

Определение нуклеотидной последовательности проводили методом терминации цепи с помощью набора реактивов ABI PRISM® BigDye™ Terminator v. 3.1, используя в качестве матрицы амплификат вставки с плазмиды pCM4 (Межинститутский Центр коллективного пользования «ГЕНОМ» ИМБ РАН, http://www.genome-centre.narod.ru/). Последовательность нуклеотидов депонировали в международную базу данных GenBank под номером AN EU 678894.



Pages:   || 2 | 3 | 4 |
 


Похожие работы:







 
2013 www.деньсилы.рф - «МЕДИЦИНА-ЛЕЧЕНИЕ-ОЗДОРОВЛЕНИЕ»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.